Archive for category: Chemistry

QUESTION 1

1. Label the following on this single-stranded DNA molecule:

1. Phosphodiester bond
2. Deoxyribose sugar

iii. Nitrogenous bases

1. 5’ end
2. 3’ end

What type of interaction will the bases of this strand have with a complementary strand of DNA? Which of the sequences (A-D) are complementary to the target sequence?

QUESTION 2

Below is a generic gene structure FROM A EUKARYOTE (not bacteria). List the events that need to occur for this gene to be used to make a protein. Your list should should be as detailed as you can make it based on what you recall about how genes are expressed to make proteins.

 

QUESTION 3

Translation stop site

Transcription

stop site

Below is a generic gene structure FROM A EUKARYOTE (not bacteria). A represents a single base-pair substitution mutation. This mutation will:

MUTATION A:

1. Change the RNA sequence and could change the protein sequence
2. No change to RNA or protein sequence
3. Change RNA sequence but not change the protein sequence
4. No change to RNA sequence but could change protein sequence

 

QUESTION 4

Translation stop site

A

Transcription

stop site

Below is a generic gene structure FROM A EUKARYOTE (not bacteria). .B represents a 10 base-pair deletion mutation. This mutation will:

MUTATION B:

1. Change the RNA sequence and could change the protein sequence
2. No change to RNA or protein sequence
3. Change RNA sequence but not change the protein sequence
4. No change to RNA sequence but could change protein sequence

 

QUESTION 5

Translation stop site

B

Transcription

stop site

Below is a generic gene structure FROM A EUKARYOTE (not bacteria). C represents a 3 base-pair insertion mutation. This mutation will:

MUTATION C:

1. Change the RNA sequence and could change the protein sequence
2. No change to RNA or protein sequence
3. Change RNA sequence but not change the protein sequence
4. No change to RNA sequence but could change protein sequence

QUESTION 6

Translation stop site

C

Transcription

stop site

A double stranded sequence of DNA is shown below.

5’ GGGTATCCC 3’

3’ CCCATAGGG 5’

Note: “transcribed” below is referring to the direction that the RNA polymerase is moving* Hypothetically, if either strand could be transcribed, we state that:

1. The two DNA strands are transcribed from left to right
2. The two DNA strands are transcribed from right to left
3. Transcription of the upper DNA strand will go from left to right and the lower DNA strand is transcribed from right to left
4. The direction of transcription depends on which strand DNA polymerase binds to
5. Transcription of the upper DNA strand will go from right to left and the lower DNA strand is transcribed from left to right

QUESTION 7

The protein thorain is encoded by the gene thrL, and thorain is a negative regulator of the thrMN operon. Assume there is no other regulation taking place. Predict the phenotype of a thrL- mutant that encodes a nonfunctional thrL protein.

1. The thrM and thrN genes would be transcribed at higher levels compared to non-mutant

1. The thrM and thrN genes would be transcribed all lower levels compared to non-mutant

1. The thrM and thrN genes would not be transcribed

QUESTION 8

The TreL gene is normally transcribed in skin cells, but not in muscle cells. This difference could be because (select any/all that apply):

1. A transcription factor that activates TreL expression in skin cells is absent in muscle cells.

1. The sequence of DNA bases within the TreL promoter is different in skin and muscle cells.

1. The coding sequence of the gene is mutated in muscle cells but not skin cells.

1. The TreL gene is found within the genome of skin cells, but not within the genome of muscle cells.

QUESTION 9

A deletion mutation removes the start codon of a gene. Which of the following processes will subsequently be affected?

1. Transcription will not occur (the mRNA will not be produced)

1. Translation will not occur (the protein will not be produced)

1. DNA replication
2. DNA replication and transcription
3. DNA replication, transcription, and translation

QUESTION 10

During translation, the tRNA molecule carrying the correct amino acid corresponding to its anticodon sequence must base-pair with the codon of the mRNA. What would happen in the case where the wrong anticodon successfully binds to a codon?

1. A wrong amino acid will be added to the protein
2. The amino acid will not be added to the protein
3. No protein would be made
4. The protein would still be made, but at lower levels
5. The protein would be unaffected

QUESTION 11

Suppose that a single DNA base change of an A to a T occurs and is copied during replication. Is this change necessarily a mutation?

1. Yes, if the base change occurs in a gamete (sperm or egg cell); otherwise no.

1. Yes, if the base change occurs in the coding part of a gene; otherwise no.

1. Yes, if the base change occurs in the coding part of a gene and alters the amino acid sequence of a protein; otherwise no.

1. Yes, if the base change alters the appearance of the organism (phenotype); otherwise no.

1. Yes, it is a change in the DNA sequence.

QUESTION 12

Which of the following DNA mutations is the most likely to result in a shorter than normal mRNA ?

1. A substitution mutation at position 50 resulting in no change in the amino acid sequence

1. A substitution mutation at position 53 resulting in the UGA stop codon

1. A substitution mutation at position 58 resulting in an amino acid substitution

1. All of the above.
2. None of the above.

Below is an mRNA sequence of a gene. The first triplet of nucleotides AAU (underlined) is in frame for coding, and encodes Asparagine.

50 53 585’—AAU GAA UGG GAG CCU GAA GGA G–3’

QUESTION 13

Match the enzyme to the process:

1. DNA polymerase
2. RNA polymerase
3. Reverse transcriptase
4. DNA Ligase
5. Endonuclease
6. Cutting the phosphodiester

Backbone of DNA

2. Synthesizing a DNA molecule from a DNA template

3. Synthesizing an RNA molecule from a DNA template

4. Synthesizing a DNA molecule from an RNA template

5. Synthesizes an RNA molecule from an RNA template

6. Catalyzes the formation of a phosphodiester bond

QUESTION 14

Because DNA polymerase must add new nucleotides to a 3’OH, what is required for DNA replication to occur?

1. Ligase
2. RNA polymerase
3. Reverse transcriptase
4. Endonuclease
5. A primer

QUESTION 15

Below is the double-stranded DNA sequence for a hypothetical and very tiny gene. The promoter is coloured in yellow. The transcription start site is indicated by the bent arrow. The DNA sequence coding for the start codon is bolded. After the start codon, what is the amino acid sequence of the resulting protein?

A condensed codon table is provided.

1. Glutamine-Serine
2. Valine-Arginine
3. Glycine-Leucine
4. Proline-Aspartate

5 ’- CTATAAAGAGCCATGCAGTCC -3 ’

3 ’- GATATTTCTCGGTACGTCAGG -5 ’

QUESTION 16

You have identified a previously unknown human gene that appears to have a role in cell division. It is similar enough in DNA sequence to a known yeast gene, cdc2, that you believe the two genes may be evolutionarily related. You determine and compare the DNA sequences, the predicted mRNA sequences, and the predicted amino acid sequences corresponding to the two genes. From these comparisons, you would expect to find the greatest sequence similarity between the human and yeast:

1. DNA sequences.
2. amino acid sequences.
3. mRNA sequences.
4. All three comparisons are likely to show the same degree of sequence similarity.

QUESTION 17

A haploid species has a gene on chromosome 2 which codes for lactase. In nature, four different alleles of the lactase gene have been identified. How many different alleles could you find in the genome of a single individual of this species?

A.

1

B.

2

C.

3

D.

4 More than 4

QUESTION 18

 

QUESTION 19

Rainbow Trout are known to grow rapidly in 14°C water but you want to know whether they could be efficiently farmed in other temperatures. So, as a fisheries biologist, you ask whether differences in water temperature affect growth (weight gain). Over 8 months, you will test 50 fish in 8°C, 14°C, and room temperature water, in a controlled laboratory setting.

Which of the following represents the control group/groups in this experiment?

1. The 8°C water temperature group
2. The 14°C water temperature group
3. Both the 8°C and 14°C water temperature treatment groups
4. The room temperature water group
5. Both the 14°C and the room temperature groups

How many of the following four potential hypotheses can be tested in this experiment?

H1: Varying water temperature will have no effect on trout growth

H2: Varying water temperature will have an effect on trout growth

H3: Varying water temperature will have an effect on trout growth, such that trout will gain more weight in warmer temperatures compared to colder ones

H4: Varying water temperature will have an effect on trout growth, such that trout will only gain more weight in the warmest temperature compared to the very coldest one

1. You can only test two of these hypotheses
2. You can only test three of these hypotheses (H1 and H2, as well as H3 or H4)
3. You can only test three of these hypotheses (H1 or H2, as well as H3 and H4)
4. You can test all four of these hypotheses

QUESTION 20

Which pair of dotplots provides the strongest statistical evidence that the Training group ran faster (small times), on average, than the No Training group?

QUESTION 21

A B

C D

QUESTION 22

A particular growth factor can stimulate many types of cells to undergo cell division. A potential inhibitor of this growth factor is tested on cultures of epithelial cells grown in vitro. Culture dishes of epithelial cells are treated with different experimental conditions for two days and the amount of cell division is assessed by counting the number of cells in each dish (all dishes started with same number of cells).

1 – growth medium alone (no additions)

2 – medium plus 100 ng/ml growth factor

3 – medium plus 10 µg/ml inhibitor

4 – medium plus 100 ng/ml growth factor and 10 µg/ml inhibitor Which claim is supported by the results of the experiment?

1. The inhibitor does not block growth stimulation via the growth factor
2. The inhibitor blocks growth stimulation via the growth factor
3. The inhibitor partially blocks growth stimulation via the growth factor
4. We cannot determine if the inhibitor blocks growth stimulation via the growth factor

Explain in two-three sentences the reason for your choice